pegfp n1 plasmid (TaKaRa)
TaKaRa is a verified supplier 
TaKaRa manufactures this product 
95
Structured Review
TaKaRa
pegfp n1 plasmid
Pegfp N1 Plasmid, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 155 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pegfp+n1+plasmid+vector/%E2%97%8ApHEK293+Ultra+Expression+Vector+I/pm41899473-72-5-8
Average 95 stars, based on 155 article reviews
Pegfp N1 Plasmid, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 155 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pegfp+n1+plasmid+vector/%E2%97%8ApHEK293+Ultra+Expression+Vector+I/pm41899473-72-5-8
Average 95 stars, based on 155 article reviews
pegfp n1 plasmid - by Bioz Stars,
2026-09
95/100 stars
Images
Related Articles
Polymerase Chain Reaction:Article Title: 20E-mediated regulation of BmKr-h1 by BmKRP promotes oocyte maturation Article Snippet: .. For subcellular localization study of BmKRP, the ORF DNA fragment of BmKRP was PCR amplified with a FLAG tag and a His-tag between Kpn I and Bam H I with forward primer: 5′- GGTACCGATGGATTACAAGGATGACGACGATAAGGGTTCAAAGATACCAG-3′ and reverse primer: 5′- GGATCCCGGTGATGATGATGATGATGAATTTTTATAACCATA-3′ and cloned into Amplification:Article Title: 20E-mediated regulation of BmKr-h1 by BmKRP promotes oocyte maturation Article Snippet: .. For subcellular localization study of BmKRP, the ORF DNA fragment of BmKRP was PCR amplified with a FLAG tag and a His-tag between Kpn I and Bam H I with forward primer: 5′- GGTACCGATGGATTACAAGGATGACGACGATAAGGGTTCAAAGATACCAG-3′ and reverse primer: 5′- GGATCCCGGTGATGATGATGATGATGAATTTTTATAACCATA-3′ and cloned into FLAG-tag:Article Title: 20E-mediated regulation of BmKr-h1 by BmKRP promotes oocyte maturation Article Snippet: .. For subcellular localization study of BmKRP, the ORF DNA fragment of BmKRP was PCR amplified with a FLAG tag and a His-tag between Kpn I and Bam H I with forward primer: 5′- GGTACCGATGGATTACAAGGATGACGACGATAAGGGTTCAAAGATACCAG-3′ and reverse primer: 5′- GGATCCCGGTGATGATGATGATGATGAATTTTTATAACCATA-3′ and cloned into Clone Assay:Article Title: 20E-mediated regulation of BmKr-h1 by BmKRP promotes oocyte maturation Article Snippet: .. For subcellular localization study of BmKRP, the ORF DNA fragment of BmKRP was PCR amplified with a FLAG tag and a His-tag between Kpn I and Bam H I with forward primer: 5′- GGTACCGATGGATTACAAGGATGACGACGATAAGGGTTCAAAGATACCAG-3′ and reverse primer: 5′- GGATCCCGGTGATGATGATGATGATGAATTTTTATAACCATA-3′ and cloned into Plasmid Preparation:Article Title: 20E-mediated regulation of BmKr-h1 by BmKRP promotes oocyte maturation Article Snippet: .. For subcellular localization study of BmKRP, the ORF DNA fragment of BmKRP was PCR amplified with a FLAG tag and a His-tag between Kpn I and Bam H I with forward primer: 5′- GGTACCGATGGATTACAAGGATGACGACGATAAGGGTTCAAAGATACCAG-3′ and reverse primer: 5′- GGATCCCGGTGATGATGATGATGATGAATTTTTATAACCATA-3′ and cloned into Article Title: The Murine PSE/TATA-Dependent Transcriptome: Evidence of Functional Homologies with Its Human Counterpart Article Snippet: .. The insert was then digested with Ase I (New Labs) and subcloned into Article Title: RhoJ integrates attractive and repulsive cues in directional migration of endothelial cells Article Snippet: Non‐targeting siRNA (Stealth RNAi Negative Control Medium GC Duplex, Life Technologies) was used as a negative control. .. The transfection medium was changed to complete culture medium after 4 h. Cells were re‐transfected with siRNAs 48 h after the initial transfection and cultured for another 48 h. Transfection of plasmid vectors A cDNA cassette encoding myc‐tagged mouse PlexinD1 (PD1), PD1ΔECD, or PD1ΔRBD was replaced with an EGFP cassette in a Article Title: A simple DMSO-based method for cryopreservation of primary hippocampal and cortical neurons. Article Snippet: For treatment with glutamate, freshly prepared and cryopreserved hippocampal neurons were seeded on PLL-coated coverslips and treated with 50 M glutamate (Sigma-Aldrich) for 10 min followed by immunocytochemistry. .. For dendritic spine density analysis, the hippocampal neurons were transfected with Article Title: Controlled expression of nicotinic acetylcholine receptor-encoding genes in insects uncovers distinct mechanisms of action of the neonicotinoid insecticide dinotefuran. Article Snippet: Dinotefuran, a neonicotinoid, is a unique insecticide owing to its structure and action.. We took two approaches that employed insects with controlled expression of nicotinic acetylcholine receptor (nAChR)-encoding genes to gain insight into the uniqueness of dinotefuran.. First, we examined the insecticidal activity of dinotefuran and imidacloprid against brown planthoppers (Nilaparvata lugens), in which the expression of eight (of 13) individual subunit-encoding genes was specifically reduced using RNA interference. Article Title: A rapid degradation of calponin 2 is required for cytokinesis. Article Snippet: .. Full-length cDNA encodingmouse calponin 2 was isolated from a recombinant pAED4 plasmid via restriction enzyme digestion and inserted between the BsrGI and NotI sites of Article Title: Clarithromycin overcomes stromal cell-mediated drug resistance against proteasome inhibitors in myeloma cells via autophagy flux blockage leading to high NOXA expression. Article Snippet: Mycoplasma contamination was tested routinely using the e-MycoTM Mycoplasma PCR Detection kit ver.2.0 (iNtRON Biotechnology, Inc., Korea). .. Establishment of EGFP stably expressing MM cell lines The Article Title: RhoJ integrates attractive and repulsive cues in directional migration of endothelial cells Article Snippet: .. A cDNA cassette encoding myc‐tagged mouse PlexinD1 (PD1), PD1ΔECD, or PD1ΔRBD was replaced with an EGFP cassette in a Recombinant:Article Title: 20E-mediated regulation of BmKr-h1 by BmKRP promotes oocyte maturation Article Snippet: .. For subcellular localization study of BmKRP, the ORF DNA fragment of BmKRP was PCR amplified with a FLAG tag and a His-tag between Kpn I and Bam H I with forward primer: 5′- GGTACCGATGGATTACAAGGATGACGACGATAAGGGTTCAAAGATACCAG-3′ and reverse primer: 5′- GGATCCCGGTGATGATGATGATGATGAATTTTTATAACCATA-3′ and cloned into Article Title: A rapid degradation of calponin 2 is required for cytokinesis. Article Snippet: .. Full-length cDNA encodingmouse calponin 2 was isolated from a recombinant pAED4 plasmid via restriction enzyme digestion and inserted between the BsrGI and NotI sites of Molecular Cloning:Article Title: The Murine PSE/TATA-Dependent Transcriptome: Evidence of Functional Homologies with Its Human Counterpart Article Snippet: .. The insert was then digested with Ase I (New Labs) and subcloned into Transfection:Article Title: RhoJ integrates attractive and repulsive cues in directional migration of endothelial cells Article Snippet: Non‐targeting siRNA (Stealth RNAi Negative Control Medium GC Duplex, Life Technologies) was used as a negative control. .. The transfection medium was changed to complete culture medium after 4 h. Cells were re‐transfected with siRNAs 48 h after the initial transfection and cultured for another 48 h. Transfection of plasmid vectors A cDNA cassette encoding myc‐tagged mouse PlexinD1 (PD1), PD1ΔECD, or PD1ΔRBD was replaced with an EGFP cassette in a Article Title: A simple DMSO-based method for cryopreservation of primary hippocampal and cortical neurons. Article Snippet: For treatment with glutamate, freshly prepared and cryopreserved hippocampal neurons were seeded on PLL-coated coverslips and treated with 50 M glutamate (Sigma-Aldrich) for 10 min followed by immunocytochemistry. .. For dendritic spine density analysis, the hippocampal neurons were transfected with Cell Culture:Article Title: RhoJ integrates attractive and repulsive cues in directional migration of endothelial cells Article Snippet: Non‐targeting siRNA (Stealth RNAi Negative Control Medium GC Duplex, Life Technologies) was used as a negative control. .. The transfection medium was changed to complete culture medium after 4 h. Cells were re‐transfected with siRNAs 48 h after the initial transfection and cultured for another 48 h. Transfection of plasmid vectors A cDNA cassette encoding myc‐tagged mouse PlexinD1 (PD1), PD1ΔECD, or PD1ΔRBD was replaced with an EGFP cassette in a Isolation:Article Title: A rapid degradation of calponin 2 is required for cytokinesis. Article Snippet: .. Full-length cDNA encodingmouse calponin 2 was isolated from a recombinant pAED4 plasmid via restriction enzyme digestion and inserted between the BsrGI and NotI sites of Stable Transfection:Article Title: Clarithromycin overcomes stromal cell-mediated drug resistance against proteasome inhibitors in myeloma cells via autophagy flux blockage leading to high NOXA expression. Article Snippet: Mycoplasma contamination was tested routinely using the e-MycoTM Mycoplasma PCR Detection kit ver.2.0 (iNtRON Biotechnology, Inc., Korea). .. Establishment of EGFP stably expressing MM cell lines The Expressing:Article Title: Clarithromycin overcomes stromal cell-mediated drug resistance against proteasome inhibitors in myeloma cells via autophagy flux blockage leading to high NOXA expression. Article Snippet: Mycoplasma contamination was tested routinely using the e-MycoTM Mycoplasma PCR Detection kit ver.2.0 (iNtRON Biotechnology, Inc., Korea). .. Establishment of EGFP stably expressing MM cell lines The |
